Information

When designing primers how important is the GC clamp?


I'm designing a set of primers and reading about the principles of primer design one of which is:

GC Clamp: The presence of G or C bases within the last five bases from the 3' end of primers (GC clamp) helps promote specific binding at the 3' end due to the stronger bonding of G and C bases. More than 3 G's or C's should be avoided in the last 5 bases at the 3' end of the primer.

From here.

My question is how essential is it to have a GC clamp?


It's hard to provide an objective answer. If you have a decent length and good complexity, even a single terminal 3'GorCwould do. Of course, one has to take into account the primer's overallGC:ATratio and things like annealing temperature.

Here's a link to diverse opinions on the topic and it has this nugget (which I subscribe to when possible):

FWIW, my preferred offerings to the PCR gods are primers with a single G or C 3', FWIW. Seems to keep 'em happy most phases of the moon.


I will offer my own (empirical) account of primer design. A GC-clamp aids in specificity of the priming and therefore contributes to the overall efficiency of the PCR reaction. In the past, I have (out of necessity) designed primers that had both too much GC-clamping on the 3' end, and used primers without any GC-clamping. These PCR reactions were performed successfully, with differing levels of primer-dimer formation and overall efficiency.

In my experience, GC-clamping is nice, but not strictly required for good PCR. My general rule-of-thumb is to terminate my primers with 2 G/C wherever possible. If something is going to fail, it is not usually the PCR.


GC clamping at 3', that is having a singleGorCat the 3' end or a couple ofG/Cwithin the last 6bp at 3' end of primer, can help retain the primer on the template during elongation, because of stronger bonding compared toA=T. This is not mandatory; it's one of the characters of the primer which might improve your PCR reaction.

At the same time, avoid a sequential combination ofGCin the last 6bp which might lead to self-dimers.

Example:
5'-… GCGC-3'has higher chance of dimer formation than5'-… GCCG-3'; in such cases you can still use the latter primer sequence.


Unless you are PCRing something you know to be challenging, just use primer3 and don't worry about it.

http://bioinfo.ut.ee/primer3-0.4.0/


How to Design Primers for QPCR

Quantitative or real-time PCR is used as a routine assay for the monitoring the relative changes in gene expression under different experimental conditions. Designing of primers as well as probes during QPCR is one of the most crucial factors that affect the quality and success of the assay. Several guidelines are applicable for the design of primers for QPCR: GC content of primers should be 35-65% melting temperature of the primers should be within 60-68 °C one should also avoid secondary structures, the repeats of Gs or Cs that are longer than 3 bases, and the formation of primer-dimers.

Key Areas Covered

1. What is QPCR
– Definition, Process, Uses
2. How to Design Primers for QPCR
– Guidelines for the Primer Design for QPCR

Key Terms: Fluorescent Dyes, GC Content, Melting Temperature, Primers, Quantitative PCR (QPCR)


Primer design - GC clamp

Because G's and C's bind more strongly than A and T, having too many of them at the end of a primer can cause the Tm to increase and make it so that the GC clamp of the primer is too strong, disallowing it from denaturing at the appropriate temperature. Having 1 or 2 G's or C's at the end of the primer is ideal, becuase it allows for strong binding of the primer to the cDNA, making it more specific, without binding too strongly.

#3 Tintin

#4 altobarn

#5 wilson_trace

I'm using an Internet freely available software to design primers. The tool would then tell me if the primer is nicely designed or not. In some cases I get the warning saying ''There are more than 3 G's or C's in the last 5 bases''. What would happen if I do have the primer in that case?

Hi,
As far as I know, having a high GC content facilitates tight binding of the oligo to the template but also increases the possibility of mispriming.
May I know, which software are you using to check your primers? I use NetPrimer from Primer Biosoft: http://www.premierbi. imer/index.html

#6 phage434

#7 Bassaml7

#8 LaLeLi

This question about the GC clamp on 3' ends of primers interests me a lot.
Right now, I'm using Primer 3 to pick primers from a sequence and in the GC clamp parameter field, I've chosen GC clamp equal to 0, 1 or 2 and picked primers for each situation (everything else equal). The resulting reverse primers were different for each and only the forward primer resulting from a situation of a GC clamp = 0 was different from the others.

I've had some problems trying to amplify this locus with the original primers designed for it. They're supposed to work in a conserved region (an exon), but the amplifications I got were never consistent when it comes to the amplified band intensity. So I decided to try and pick other primers more inside the exons flanking my target sequence, in hopes of having working primers that might not be subjected to any putative mutation.

So, I wonder if the primers picked with GC clamp = 0 will force a less specific amplification, but on the other had will increase the changes of yielding any product at all, specially to proceed to sequencing afterwards?


Results and Discussion

To determine whether the GC-clamp should be attached to the 5′- or 3′-end of each PCR fragment, the respective melting maps need to be compared. As an example we show the theoretical melt curves of exon 8 of the RET gene ( Fig. 1A). When attaching the GC-clamp to the forward primer several melting domains were predicted ( Fig. 1B). When, however, a GC-clamp is attached to the reverse primer an ideal two-domain melting profile consisting of a single flat lower melting domain is created. However, such an optimal two-domain melting profile is not found in all situations. This raises the question whether PCR fragments with imperfect melt plots can be used for the appropriate detection of base pair variations and whether simple modifications of the PCR fragments/primer sequences can alter unsuitable (DGGE) fragments to become suitable for DGGE analysis whilst still maintaining optimal mutation detection. In the following we present examples of a number of such situations.

Multiple melting domains

When a DNA fragment with two or more different melting domains is separated by electrophoresis in a DGGE gel, the fragment will be arrested at the position in the gel where the denaturant concentration dissociates the fragment at its lowest melting domain. As mobility decreases, the fragment may not reach the position in the gel where the second melting domain will melt. Most of these partially melted fragments appear as sharp and focused bands, giving the idea that the fragment is suitable for mutation detection by DGGE. When fragments contain two melting domains (not taking into account the GC-clamp), the most obvious solution to this problem is to divide this fragment into two amplicons. This, however, is not always necessary. To illustrate that fragments with imperfect melt curves can be used for DGGE we present exon 13 of the MSH2 gene ( Fig. 2A). When analysing the fragment with a GC-clamp we could only get the ‘ideal’ melt plot when the primer was located within the exon. When choosing the GC-clamped primer 99 bp upstream from the intron-exon boundary, a (4°C) lower melting domain between the GC-clamp and 3′-end higher melting domain of the fragment appeared ( Fig. 2B). This fragment melted out as a smear ( Fig. 2C) and a known frameshift mutation (del693T 9) could not be detected ( Fig. 2B). When choosing a GC-clamped primer 29 bp upstream from the intron-exon boundary, the interior lowest melting domain at the 5′-end of the fragment had a Tm value 1.0°C lower than the second domain ( Fig. 2E). The del693T mutation could be detected easily ( Fig. 2F).

From this example and several comparable cases tested, we conclude that a fragment with an interior low melting domain can be used for DGGE, provided that the Tm value of this low melting domain differs by not more than 1°C from the adjacent domains and is not larger than 50–100 bp in length.

Multiple melting domains: theoretical melt maps and experimental DGGE analysis for MSH2 exon 13 and its flanking intronic sequences. (A) Melt map of a 328 bp fragment without GC-clamp shows two stable temperature domains. (B) Melt map of the fragment with GC-clamp shows an interior melting domain with a Tm value differing by 4°C from the second domain (solid line). (C) Time-travel DGGE analysis of the 328 bp fragment with the GC-clamp at the 5′-end. The mutation (del693T) could not be detected. (D) Melt map of a 258 bp fragment without a GC-clamp. A 70 bp intronic sequence was removed from the 5′-end of the original 328 bp fragment. (E) Melt map of the 258 bp fragment with a GC-clamp shows an interior melting domain having a Tm value 0.5°C lower than the second domain (solid line). (F) Time-travel DGGE analysis of the 258 bp fragment with the GC-clamp at the 5′-end. The mutation (del693T) could now be detected.

Multiple melting domains: theoretical melt maps and experimental DGGE analysis for MSH2 exon 13 and its flanking intronic sequences. (A) Melt map of a 328 bp fragment without GC-clamp shows two stable temperature domains. (B) Melt map of the fragment with GC-clamp shows an interior melting domain with a Tm value differing by 4°C from the second domain (solid line). (C) Time-travel DGGE analysis of the 328 bp fragment with the GC-clamp at the 5′-end. The mutation (del693T) could not be detected. (D) Melt map of a 258 bp fragment without a GC-clamp. A 70 bp intronic sequence was removed from the 5′-end of the original 328 bp fragment. (E) Melt map of the 258 bp fragment with a GC-clamp shows an interior melting domain having a Tm value 0.5°C lower than the second domain (solid line). (F) Time-travel DGGE analysis of the 258 bp fragment with the GC-clamp at the 5′-end. The mutation (del693T) could now be detected.

Attachment of G/C nucleotides

When a DNA fragment consists of three melting domains (as depicted in Fig. 3A) mutation detection is only possible in the lowest melting domain and is not possible in the higher (non-melted) domain. When this lowest melting domain is short, <50 bp, and is on one of the ends of the fragment ( Fig. 3A) a solution for this condition is the addition of a stretch of G/C nucleotides (three to seven) to this end of the fragment through the short primer. This modified primer will increase the Tm value of the small lowest melting domain and thereby promote the establishment of the desired two-domain profile. To illustrate the results of adding G and/or C residues to the short primer, we examined exon 7 of the BRCA2 gene ( Fig. 3A). To determine the melting behaviour of the fragment, we introduced a mutation in the forward primer ( 10). The fragments without an added stretch of GC nucleotides showed a reduction in mobility and appeared as a single sharp focused band after 5 h electrophoresis at 150 V ( Fig. 3B). The results can only be interpreted as absence of mutations in this fragment. When three bases (CGC) were attached to the 3′-end of the fragment, through the reverse short primer, the calculated melting map of this fragment predicted that the Tm of the lowest melting domain would differ by ∼1°C from the other domain ( Fig. 3C). Although the melt curve is not optimal, the mutation could be detected after 7–8 h electrophoresis at 150 V ( Fig. 3D). When five or seven bases were added to the 3′-end of the fragment, the theoretical desired two-domain profile was created and the mutation was resolved after 6–7 h electrophoresis at 150 V (data not shown).

Attachment of G/C nucleotides: theoretical melt maps and experimental DGGE analysis for BRCA2 exon 7 and its flanking intronic sequences. (A) Melt map of a 203 bp fragment without (solid line) and with GC-clamp (dashed line) shows multiple melting domains. (B) Time-travel DGGE analysis of the 203 bp fragment. The fragment appears as a single focused band and the mutation could not be detected. (C) Melt map of the fragment without (solid line) and with a GC-clamp (dashed line) shows that the Tm value of the lowest melting domain differs by only ∼1°C from the other domain when three bases (GCG) are added to the 3′-end. (D) Time-travel DGGE analysis of the fragment with three bases (GCG) added at the reverse short primer. The mutation is readily detected.

Attachment of G/C nucleotides: theoretical melt maps and experimental DGGE analysis for BRCA2 exon 7 and its flanking intronic sequences. (A) Melt map of a 203 bp fragment without (solid line) and with GC-clamp (dashed line) shows multiple melting domains. (B) Time-travel DGGE analysis of the 203 bp fragment. The fragment appears as a single focused band and the mutation could not be detected. (C) Melt map of the fragment without (solid line) and with a GC-clamp (dashed line) shows that the Tm value of the lowest melting domain differs by only ∼1°C from the other domain when three bases (GCG) are added to the 3′-end. (D) Time-travel DGGE analysis of the fragment with three bases (GCG) added at the reverse short primer. The mutation is readily detected.

Thus, based on computer calculations and practical experimentation, we propose that the attachment of a small stretch of G/C nucleotides to the short primer may improve mutation detection under these conditions. It should be noted, however, that the stretch of G/C nucleotides should not exceed 10 bases, since that will introduce a small highly GC-rich portion into the fragment, resulting in smears or diffuse bands in a DGGE gel (data not shown).

Attachment of A/T nucleotides

When sequence information is limited it might be impossible to select primers without having a GC-rich domain near the GC-clamp attachment site of the fragment ( Fig. 4A). As a consequence, mutations in these higher melting domains will be missed. We hypothesized that insertion of a stretch of 15–20 T nucleotides between the GC-clamp and the specific primer might decrease the Tm value of the GC-rich sequence and thereby make mutation detection possible in the higher melting domain. To test this we examined exon 9 of the MSH2 gene ( Fig. 4A). To obtain the (theoretically) desired two-domain melting profile, 20 T nucleotides had to be inserted at the 3′-end or 15 T nucleotides at the 5′-end between the GC-clamp and specific primer ( Fig. 4C). To test this we examined a g→t substitution located at the splice acceptor site in intron 8 ( 9) present in a high melting domain. As expected, given its location within the highly GC-rich portion at nucleotide position −1 ( Fig. 4A), the mutation could not be detected when the GC-clamp was directly attached to the forward primer ( Fig. 4B). The mutation, however, was detected when 15 T nucleotides were inserted between the GC-clamp and the forward primer ( Fig. 4D).

Attachment of A/T nucleotides: theoretical melt maps and experimental DGGE analysis for MSH2 exon 9 and its flanking intronic sequences. (A) Melt map of a 208 bp fragment with a GC-clamp on both sides shows high melting domains on either side. (B) Time-travel DGGE analysis of the 208 bp fragment with the GC-clamp at the 5′-end. A splice site mutation located within the high melting domain could not be detected. (C) Melt map of the fragment shows an optimal two-domain melting profile when 20 T nucleotides are inserted between the reverse primer and the GC-clamp (dashed line) or 15 T nucleotides between the forward primer and the GC-clamp (solid line). (D) Time-travel DGGE analysis of the 208 bp fragment with 15 T nucleotides between the forward primer and the GC-clamp. The mutation is clearly visible.

Attachment of A/T nucleotides: theoretical melt maps and experimental DGGE analysis for MSH2 exon 9 and its flanking intronic sequences. (A) Melt map of a 208 bp fragment with a GC-clamp on both sides shows high melting domains on either side. (B) Time-travel DGGE analysis of the 208 bp fragment with the GC-clamp at the 5′-end. A splice site mutation located within the high melting domain could not be detected. (C) Melt map of the fragment shows an optimal two-domain melting profile when 20 T nucleotides are inserted between the reverse primer and the GC-clamp (dashed line) or 15 T nucleotides between the forward primer and the GC-clamp (solid line). (D) Time-travel DGGE analysis of the 208 bp fragment with 15 T nucleotides between the forward primer and the GC-clamp. The mutation is clearly visible.

The insertion of T nucleotides between the GC-clamp and specific primer enables mutation detection in small highly GC-rich regions near the GC-clamped primer.

High melting domain at the end of a DNA fragment: theoretical melt maps and experimental DGGE analysis for RET exon 13 and its flanking intronic sequences. (A) The melt map of a 278 bp fragment without GC-clamp (solid line) shows a high melting domain at the 3′-end. An ideal two-domain profile is obtained by attaching a GC-clamp to the 5′-end (dashed line). (B) Time-travel DGGE analysis of the 278 bp fragment with a high melting domain at the 3′-end. The fragment gave indistinct bands and the mutation (S767R) could not be detected. (C) Melt map of a 234 bp fragment without GC-clamp (solid line) shows a single melting domain. A 44 bp intronic sequence was removed from the 3′-end of the 278 bp fragment. Melt map of the 234 bp fragment with GC-clamp (dashed line) shows two domains with slightly different Tm. (D) Time-travel DGGE analysis of the 234 bp fragment without high melting domain at the 3′-end. The mutation (S767R) is clearly visible.

High melting domain at the end of a DNA fragment: theoretical melt maps and experimental DGGE analysis for RET exon 13 and its flanking intronic sequences. (A) The melt map of a 278 bp fragment without GC-clamp (solid line) shows a high melting domain at the 3′-end. An ideal two-domain profile is obtained by attaching a GC-clamp to the 5′-end (dashed line). (B) Time-travel DGGE analysis of the 278 bp fragment with a high melting domain at the 3′-end. The fragment gave indistinct bands and the mutation (S767R) could not be detected. (C) Melt map of a 234 bp fragment without GC-clamp (solid line) shows a single melting domain. A 44 bp intronic sequence was removed from the 3′-end of the 278 bp fragment. Melt map of the 234 bp fragment with GC-clamp (dashed line) shows two domains with slightly different Tm. (D) Time-travel DGGE analysis of the 234 bp fragment without high melting domain at the 3′-end. The mutation (S767R) is clearly visible.

High melting domain at the end of a DNA fragment

We came across several amplicons with perfect melt curves (fragments with GC-clamp) that, however, when electrophoresed in a DGGE gel resulted in smears or diffuse bands. Upon analysis of the melt curve of the native sequences (fragments without GC-clamp), we observed that a high melting domain was present at one end of the fragment. The effect of this high melting domain on mutation detection by DGGE can be illustrated by an analysis of exon 13 of the RET gene ( Fig. 5A). The DGGE analysis of a T→G substitution (S767R) in exon 13 of the RET gene located at nucleotide position 18 of the fragment shows that only indistinct bands can be observed ( Fig. 5B). This demonstrates a discrepancy between the theoretical melt plot calculated by MELT87 and the practical ‘real’ melting behaviour of the PCR fragment. The easiest way to solve this problem is to remove the GC-rich sequence. In this case, we could remove 44 bp from the 3′-end of the fragment without removing any of the coding sequence. Although the theoretical melting curve is not perfect ( Fig. 5C), Figure 5D shows four distinct bands. Similar theoretical data and practical observations were obtained for exons 14 and 15 of the RET gene (data not shown). Since it has been reported that a short stretch of AT-rich sequence could decrease the Tm value of a small GC-rich region ( 11), we tried to solve the above mentioned problem by introducing a stretch of seven AT nucleotides at the 3′-end of the reverse short primer. This was, however, unsuccessful (data not shown). Use of a longer stretch of AT nucleotides (>20 nt) will introduce a low melting domain resulting in a non-optimal three-domain structure.

High melting domain in the middle of a fragment: theoretical melt map and experimental DGGE analysis for CFTR exon 2 and its flanking intronic sequences. (A) Melt map of a 217 bp fragment without GC-clamp (solid line) shows a high melting domain in the middle part of this fragment. An ideal two-domain profile is obtained by attaching a GC-clamp to the 3′-end (dashed line). (B) DGGE analysis of the 217 bp fragment reveals the detection of all three mutations by the presence of three or four bands. Lanes 1–4 show a control sample, 186-13c→g, 241delAT and 296+2t→c, respectively.

High melting domain in the middle of a fragment: theoretical melt map and experimental DGGE analysis for CFTR exon 2 and its flanking intronic sequences. (A) Melt map of a 217 bp fragment without GC-clamp (solid line) shows a high melting domain in the middle part of this fragment. An ideal two-domain profile is obtained by attaching a GC-clamp to the 3′-end (dashed line). (B) DGGE analysis of the 217 bp fragment reveals the detection of all three mutations by the presence of three or four bands. Lanes 1–4 show a control sample, 186-13c→g, 241delAT and 296+2t→c, respectively.

Length of GC-clamp: theoretical melt map and experimental DGGE analysis for RET exon 5 and its flanking intronic sequences. (A) Melt maps of a 295 bp fragment with a GC-clamp of 40 (solid line) and of 60 bp (dashed line) show similar melting profiles. (B) Time-travel DGGE analysis of the 295 bp fragment with a 40 bp GC-clamp. The fragment appears as diffuse bands after 8 h electrophoresis at 150 V. (C) Time-travel DGGE analysis of the 295 bp fragment with a 60 bp GC-clamp. The fragment gives a sharply focused band.

Length of GC-clamp: theoretical melt map and experimental DGGE analysis for RET exon 5 and its flanking intronic sequences. (A) Melt maps of a 295 bp fragment with a GC-clamp of 40 (solid line) and of 60 bp (dashed line) show similar melting profiles. (B) Time-travel DGGE analysis of the 295 bp fragment with a 40 bp GC-clamp. The fragment appears as diffuse bands after 8 h electrophoresis at 150 V. (C) Time-travel DGGE analysis of the 295 bp fragment with a 60 bp GC-clamp. The fragment gives a sharply focused band.

If the melting analysis of a short fragment (<200 bp) predicts a high melting domain <40 bp in size located at the end of the fragment and differing by not more than 5°C in Tm value, this fragment most probably is suitable for DGGE analysis. When, however, a high melting domain (>50 bp in size and differing from the rest by ∼5°C in Tm value) is located at one end of a DNA fragment it may significantly affect the melting behaviour of the fragment even after attachment of a GC-clamp.

Naturally occurring clamp: theoretical melt maps and experimental DGGE analysis for MSH2 exon 1 and its flanking intronic sequences. (A) Melt map of a 271 bp fragment with a 40 bp GC-clamp at the 5′-end (dashed line) shows an ideal two-domain profile. (B) Time-travel DGGE analysis of the 271 bp fragment with the 40 bp GC-clamp. The fragment became completely single-stranded and ran off the gel after 7 h electrophoresis at 150 V. (C) Melt map of a 299 bp fragment without GC-clamp (solid line) shows a naturally occurring high melting domain of ∼60 bp at the 3′-end. Melt map of the 299 bp fragment with a 55 bp GC-clamp showing a high melting domain of ∼100 bp at the 3′-end. (D) Time-travel DGGE analysis of the 299 bp fragment with the 55 bp GC-clamp. The fragment gives a single sharp band after 9 h electrophoresis at 150 V.

Naturally occurring clamp: theoretical melt maps and experimental DGGE analysis for MSH2 exon 1 and its flanking intronic sequences. (A) Melt map of a 271 bp fragment with a 40 bp GC-clamp at the 5′-end (dashed line) shows an ideal two-domain profile. (B) Time-travel DGGE analysis of the 271 bp fragment with the 40 bp GC-clamp. The fragment became completely single-stranded and ran off the gel after 7 h electrophoresis at 150 V. (C) Melt map of a 299 bp fragment without GC-clamp (solid line) shows a naturally occurring high melting domain of ∼60 bp at the 3′-end. Melt map of the 299 bp fragment with a 55 bp GC-clamp showing a high melting domain of ∼100 bp at the 3′-end. (D) Time-travel DGGE analysis of the 299 bp fragment with the 55 bp GC-clamp. The fragment gives a single sharp band after 9 h electrophoresis at 150 V.

High melting domain in the middle of a fragment

From the foregoing it is clear that in designing a DGGE mutation detection system, melt curves of both the clamped and the unclamped fragments need to be examined. In several cases we found a GC-rich domain in the middle of a fragment, visible as a peak in the melting profile of the native sequence, but not seen after addition of a GC-clamp ( Fig. 6A). To determine whether such a high melting domain has an influence on the detection of mutations in the domain, we examined CFTR exon 2, of which the melt map with and without a 3′-GC-clamp is shown in Figure 6A. We examined three known mutations located in the middle of this fragment: 186-13c→g at nucleotide position −13 241delAT at nucleotide position 39 of the fragment, located in the peak of the melting domain (79°C) 296+2t→c at nucleotide position +2 ( Fig. 6A). Figure 6B shows a DGGE analysis of the three mutations in exon 2 of the CFTR gene. All three mutations were easily detected. Similar theoretical data and practical observations were obtained for exon 5 of the TP53 gene, which has a somewhat broader peak in the middle of the fragment (data not shown). Thus, mutations located in such high melting domains do not pose a problem for detection.

For DGGE, preferentially short PCR fragments (<300 bp) should be chosen, because a GC-clamp has a stronger effect on the melting properties of short fragments. Fragments suitable for DGGE can thus be generated more easily. In long fragments (>400 bp), a large internal high melting domain (100 bp) may have a substantial impact, as the GC-clamp has relatively little effect on the melting behaviour of the central portion, for instance, exon 4 of the TP53 gene ( 11). Mutations located in the high melting domain (100 bp long, differing by 6°C in Tm value) and in the domain between this high melting domain and GC-clamp could not be detected using a single PCR fragment in DGGE (data not shown).

We conclude that whereas the presence of a high melting domain in the middle of a small fragment (<300 bp) still allows a good mutation analysis, its presence in the middle of a large PCR fragment (>400 bp) makes the fragment unsuitable for DGGE analysis.

Length of GC-clamp

Several studies ( 3, 5) have indicated that a GC-clamp as short as 30 bp would be sufficient in DGGE. This may be true for AT-rich fragments, but for a GC-rich sequence the difference in Tm with a GC-clamp might become too small. Even the standard 40 bp GC-clamp might not be sufficient to prevent total strand dissociation. Here, we demonstrate the effect of the length of the GC-clamp on GC-rich fragments with exon 5 of the RET gene as an example. The melting analysis of the fragment revealed a Tm value of 80°C. Attachment of 40 and 60 bp GC-clamps to the 3′-end of the fragment gave similar theoretical melting profiles ( Fig. 7A). The fragment with the 40 bp GC-clamp becomes completely single-stranded and runs off the gel ( Fig. 7B and also Fig. 8A and B), whereas the 60 bp GC-clamped fragment melted as a single sharp band ( Fig. 7C).

For extremely GC-rich sequences (Tm > 80°C), as is usually the case for the first exon of most genes, the difference in Tm values between GC-clamp and target sequence may be so small that even a 60 bp GC-clamp may not be sufficient to prevent total strand dissociation, although the melt curve might be perfect. If possible, a naturally occurring, high melting domain in combination with a longer GC-clamp may be used ( Fig. 8C). As an example we show exon 1 of the MSH2 gene ( Fig. 8A–D). When analysing the melting behaviour of a 299 bp fragment, a naturally occurring, high melting domain of ∼60 bp at the 3′-end of the fragment becomes visible ( Fig. 8C). By adding a 55 bp GC-clamp to the 3′-end of this molecule, a high melting domain of ∼100 bp was created ( Fig. 8C). When running this PCR fragment in a DGGE gel it resulted in a single sharp band melting at an appropriate UF concentration ( Fig. 8D).

We conclude that for fragments with a Tm value close to 80°C a GC-clamp with a length of 60 bp will improve mutation detection. DGGE for fragments with a Tm value >80°C might only be possible when making use of a long GC-clamp in combination with a ‘naturally’ occurring GC-rich domain.


DESIGN PCR PRIMERS

BACKGROUND INFORMATION: For sites describing PCR theory, as well as companies marketing PCR products you might want to begin by visiting Highveld. For PCR techniques see PCRlink.com.

There are several excellent sites for designing PCR primers:

Primer3: WWW primer tool (University of Massachusetts Medical School, U.S.A.) &ndash This site has a very powerful PCR primer design program permitting one considerable control over the nature of the primers, including size of product desired, primer size and Tm range, and presence/absence of a 3&rsquo-GC clamp.
GeneFisher - Interactive PCR Primer Design (Universitat Bielefeld, Germany) - a very good site allowing great control over primer design.

Primer3Plus - a new improved web interface to the popular Primer3 primer design program ( Reference: A. Untergasser et al. 2007. Nucl. Acids Res. 35(Web Server issue):W71-W74)
BiSearch Primer Design and Search Tool - this is a useful tool for primer-design for any DNA template and especially for bisulfite-treated genomes. The ePCR tool provides fast detection of mispriming sites and alternative PCR products in cDNA libraries and native or bisulfite-treated genomes. ( Reference: Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST was developed at NCBI to help users make primers that are specific to the input PCR template. It uses Primer3 to design PCR primers and then submits them to BLAST search against user-selected database. The blast results are then automatically analyzed to avoid primer pairs that can cause amplification of targets other than the input template.

MFEprimer allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. This server uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported. ( Reference: Qu W et al. 2012. Nucl. Acids Res. 40 (Web Server issue): W205-W208)

Primer Design and Search Tool

PrimerDesign-M - includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions. ( Reference: Yoon H & Leitner T. 2015. Bioinformatics 31:1472-1474).

RF-cloning (Restriction-free cloning) - is a PCR-based technology that expands on the QuikChange&trade mutagenesis process originally popularized by Stratagene in the mid-1990s, and allows the insertion of essentially any sequence into any plasmid at any location. ( Reference: Bond SR & Naus CC. 2012. Nucl. Acids Res 40(Web Server issue): W209-W213)

primers4clades - is a pipeline for the design of PCR primers for cross-species amplification of novel sequences from metagenomic DNA or from uncharacterized organisms belonging to user-specified phylogenetic lineages. It implements an extended CODEHOP strategy based on both DNA and protein multiple alignments of coding genes and evaluates thermodynamic properties of the oligonucleotide pairs, as well as the phylogenetic information content of predicted amplicons,computed from the branch support values of maximum likelihood phylogenies. Trees displayed on screen make it easy to target primers to interactively selected clades. ( Reference: Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Web Server issue):W95-W100).

TaxMan: Inspect your rRNA amplicons and taxa assignments - In microbiome analyses, often rRNA gene databases are used to assign taxonomic names to sequence reads. The TaxMan server facilitates the analysis of the taxonomic distribution of your reads in two ways. First, you can check what taxonomic names are assigned to the sequences produced by your primers and what taxa you will lose. Second, the produced amplicon sequences with lineages in the FASTA header can be downloaded. This can result in a much more efficient analysis with respect to run time and memory usage, since the amplicon sequences are considerably shorter than the full length rRNA gene sequences. In addition, you can download a lineage file that includes the counts of all taxa for your primers and for the used reference. ( Reference: Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Oligonucleotide physicochemical parameters:

NetPrimer (Premier Biosoft International, U.S.A.) - In my opinion the best site since it provides one with Tm, thermodynamic properties and most stable hairpin & dimers.BUT it takes a while for the program to load.

dnaMATE - calculates a consensus Tm for short DNA sequence (16-30 nts) using a merged method that is based on three different thermodynamic tables. The consensus Tm value is a robust and accurate estimation of melting temperature for short DNA sequences of practical application in molecular biology. Accuracy benchmarks using all experimental data available indicate that the consensus Tm prediction errors will be within 5 ºC from the experimental value in 89% of the cases. ( Reference: A. Panjkovich et al. 2005. Nucl. Acids Res. 33: W570-W572.).

OligoCalc - an online oligonucleotide properties calculator - ( Reference: W.A. Kibbe. 2007. Nucl. Acids Res. 35(Web Server issue):W43-W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc )
Mongo Oligo Mass Calculator v2.06
OligoEvaluator (Sigma -Aldrich)
Oligo Calculation Tool (Genescript, U.S.A.) - allows modification

PCR primers based upon protein sequence:

If you has the protein sequence and want the DNA sequence the best sites are Protein to DNA reverse translation or Reverse Translation part of the Sequence Manipulation Suite . If you are interested in changing a specific amino acid into another you should consult Primaclade ( Reference: Gadberry MD et al. 2005. Bioinformatics 21:1263-1264).

PCR and cloning:

AMUSER (Automated DNA Modifications with USER cloning) offers quick and easy design of PCR primers optimized for various USER cloning based DNA engineering. USER cloning is a fast and versatile method for engineering of plasmid DNA. This Web server tool automates the design of optimal PCR primers for several distinct USER cloning-based applications. It facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. ( Reference: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Genomic scale primers: (N.B. also see the JAVA page for additional downloadable programs)

The PCR Suite (Klinische Genetica, Erasmus MC Rotterdam, Netherlands) - this is a suite of four programs based upon Primer3 for genomic primer design. All offer considerable control on primer properties:

Overlapping_Primers - creates multiple overlapping PCR products in one sequence.
Genomic_Primers - designs primers around exons in genomic sequence. All you need is a GenBank file containing your gene.
SNP_Primers - designs primers around every SNP in a GenBank file.
cDNA_Primers - designs primers around open reading frames. Simply upload a GenBank file containing your genes.

Overlapping primer sets:

Two sites offer software is based on the Primer3 program for design overlapping PCR primer pair sets - Multiple Primer Design with Primer 3 and Overlapping Primersets

PHUSER (Primer Help for USER ) - Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. The primers have similar annealing temperature (Tm). PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer secondary structures and the presence of polyN stretches. ( Reference: Olsen LR et al. 2011. Nucl. Acids Res. 39 (Web Server issue): W61-W70)

Primerize is a Web Server for primer designs of DNA sequence PCR assembly. Primerize is optimized to reduce primer boundaries mispriming, is designed for fixed sequences of RNA problems, and passed wide and stringent tests. This efficient algorithm is suitable for extended use such as massively parallel mutagenesis library. ( Reference: Tian, S., & Das, R. (2016) Quarterly Review of Biophysics 49(e7): 1-30).

Short interfering RNA (siRNA) design:

Small interfering RNA (siRNA) guides sequence-specific degradation of the homologous mRNA, thus producing "knock-down" cells. siRNA design tool scans a target gene for candidate siRNA sequences that satisfy user-adjustable rules. A variety of servers exist:

siRNA Design Software - compares existing design tools, including those listed above. They also attempt to improve the MPI principles and existing tools by an algorithm that can filter ineffective siRNAs. The algorithm is based on some new observations on the secondary structure. ( Reference: S. M. Yiu et al. (2004) Bioinformatics 21: 144-151).

OligoWalk is an online server calculating thermodynamic features of sense-antisense hybidization. It predicts the free energy changes of oligonucleotides binding to a target RNA. It can be used to design efficient siRNA targeting a given mRNA sequence. ( Reference: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - a human viral siRNA efficacy prediction server (Reference: Qureshi A et al. 2013. J Transl Med. 11:305).

Dicer-substrate siRNAs (DsiRNAs) are chemically synthesized 27-mer duplex RNAs that have increased potency in RNA interference compared to traditional siRNAs.RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Designing effective and specific plant RNAi siRNAs with genome-wide off-target gene assessment.

DSIR is a tool for siRNA (19 or 21 nt) and shRNA target design. ( Reference: Vert JP et al. 2006. BMC Bioinformatics 7:520).

Imgenex siRNA retriever program has been designed to select siRNA encoding DNA oligonucleotides that can be cloned into one of the pSuppressor vectors. The input sequence can be directly accessed from a Genbank accession or sequence provided by the researcher.

siDRM is an implementation of the DRM rule sets for selecting effective siRNAs. The authors have performed an updated analysis using the disjunctive rule merging (DRM) approach on a large and diverse dataset compiled from siRecords, and implemented the resulting rule sets in siDRM, a new online siRNA design tool. siDRM also implements a few high-sensitivity rule sets and fast rule sets, links to siRecords, and uses several filters to check unwanted detrimental effects, including innate immune responses, cell toxic effects and off-target activities in selecting siRNAs. ( Reference: Gong W et al. 2008. Bioinformatics 24:2405-2406).

siMAX siRNA Design Tool (Eurofins Genomic, Germany) - is a proprietary developed software designed to help you selecting the most appropriate siRNA targeting your gene(s) of interest.

shRNA Designer (Biosettia Inc., USA) - Use this program to design shRNA oligos that are compatible with our SORT-A/B/C vectors. The design tool provides targets with the greatest chance of knocking down your gene. Please note, only one oligo is designed as it is palindromic.

siDESIGN Center (Horizon Discovery Ltd., UK) - is an advanced, user-friendly siRNA design tool, which significantly improves the likelihood of identifying functional siRNA. One-of-a-kind options are available to enhance target specificity and adapt siRNA designs for more sophisticated experimental design.

Realtime PCR primer design:

RealTimeDesign (Biosearch Technologies) - free but requires registration.

GenScript Real-time PCR (TaqMan) Primer Design - one can customize the potential PCR amplicon's size range, Tm (melting temperature) for the primers and probes, as well as the organism. You can also decide how many Primer/Probe sets you want the tool to return to you. It is possible to use a GenBank accession number as the template.

QuantPrime - is a flexible program for reliable primer design for use in larger qPCR experiments. The flexible framework is also open for simple use in other quantification applications, such as hydrolyzation probe design for qPCR and oligonucleotide probe design for quantitative in situ hybridization. ( Reference: S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, USA)

Introduction of mutations:

WatCut (Michael Palmer, University of Waterloo, Canada) - takes an oligonucleotide and introduces silent mutations in potential restriction sites such that the amino acid sequence of the protein is unaltered.

PrimerX - can be uused to automate the design of mutagenic primers for site-directed mutagenesis. It is available in two flavours (a) Primer Design Based on DNA Sequence and (b) Primer Design Based on Protein Sequence

Primerize-2D - is designed to accelerate synthesis of large libraries of desired mutants through design and efficient organization of primers. The underlying program and graphical interface have been experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides and libraries encompassing up to 960 variants. ( Reference: Tian, S., & Das, R. (2017) Bioinformatics 33(9): 1405-1406).

When you are ready to set-up your PCR reaction see:

PCR Box Titration Calculator (Allotron Biosensor Corporation) - for figuring out the amounts of each reagent to use in a two-dimensional box titration for PCR. For standard PCR reactions adjust volume, and change "row" and "column" number to "1", click on all the "top" or "bottom" and "done". PCR Titration Calculator (Angel Herráez Cybertory: virtual molecular biology lab Universidad de Alcalá, Spain) is a similar site.

PCR Reaction Mixture Setup (R. Kalendar, University of Helsinki, Finland) - very nice site (requires Java).

PCR Optimization (Bioline, United Kingdom) - a lot of conditions

Primer presentation on the DNA sequence:

Sequence Extractor (Paul Stothard) - generates a clickable restriction map and PCR primer map of a DNA sequence (accepted formats are: raw, GenBank, EMBL, and FASTA) offering a great deal of control on output. Protein translations and intron/exon boundaries are also shown. Use Sequence Extractor to build DNA constructs in silico.


LABORATORY EXPERIMENT: SYBR® GREEN-BASED PRIMER DESIGN USING PRIMER3 SOFTWARE

Background

Fluorescent Chemistries of qPCR

To quantify the amount of mRNA, DNA, or cDNA in a sample, the use of nonspecific or sequence-specific fluorescent signals can be used in conjunction with RT-PCR. Sequence-specific detection (e.g. TaqMan®, Moeg, Molecular Beacon, and Scorpion) use specially designed probes that have fluorophores bound to their 5′ end and quenchers bound to their 3′ end (Fig. 1). Fluorophores are molecules (or part of a molecule) that become excited in the presence of light and release fluorescence. The quencher is a molecule that extinguishes the fluorescence. When a qPCR reaction is ran using a specialized thermocycler (e.g. BioRad iCycler), the optical module of the thermocycler selects the correct wavelength of light and reflects it into the well where the PCR reaction mix is located. The fluorophore molecules become excited and fluoresce, and then the thermocycler's optical detection system measures and quantifies the amount of fluorescent emission present in each tube. For example: a TaqMan®-based experiment would require a fluorogenic probe along with the sequence specific primers to be added to the PCR reaction mixture. The probe is an oligonucleotide sequence, which is designed to hybridize to an internal region of the PCR product. It contains the fluorescent reporter dye (fluorophore) attached to its 5′ end and a quencher moiety attached to the 3′ end (Fig. 1). The fluorophore and quencher are separated by the length of the probe. The distance is close enough to allow the fluorescence from the quencher to block the fluorescent signal of the fluorophore. This prevents the detection of the fluorescent signal from the probe. During the annealing cycle, the probe will anneal to its target sequence in-between the forward and reverse primer. As long as the probe is intact, the fluorescence of the reporter dye is quenched however, when DNA polymerase extends the primer and replicates the template on which the TaqMan® probe is bound, the exonuclease activity of the polymerase cleaves the probe, releasing the reporter molecule and allowing its fluorescence to be detected. The process is repeated during each cycle of the PCR, increasing the level of fluorescence as additional probes are cleaved. These types of detection are ideal for detecting single nucleotide polymorphisms or detection of specific sequences. The probes can be labeled with different reporter dyes allowing the user to detect more than one specific sequence in a sample (this is called a multiplex qPCR).

TaqMan® and SYBR® Green Fluorescent Chemistries. TaqMan® (1) utilizes a probe which consists of an oligonucleotide sequence with a 5′ fluorescent reporter molecule (F) and a 3′ quencher dye (Q). As long as the probe is attached, the signal from the quencher dye (often a long wavelength colored dye) disrupts the signal of the fluorophore (usually a sholrt wavelength colored dye). Taq polymerase extends the primer (2) and replicates the template on which the TaqMan® probe is bound. The exonuclease activity of Taq polymerase (3) cleaves the probe, releasing the 5′ fluorophore (reporter dye) allowing fluorescence to occur. SYBR® Green intercalates dsDNA. When it is free in the reaction mix (1), it emits only small amounts of fluorescence. As primers are extended by Taq, polymerase, and replication of the template occurs, more SYBR® Green is intercalated into the replicated strand (2). Fluorescence increases as strands are replicated (3).

Nonspecific detection uses fluorescent dyes like SYBR® Green I. When SYBR® Green dye is added to a PCR reaction mixture, it will immediately bind to any dsDNA present and emit a fluorescent signal that is 1,000 fold greater than unbound SYBR® Green [ 5 ]. As the thermocycler rotates through its cycles (denature→anneal→extend), new amplicons are synthesized by Taq polymerase and are immediately bound by the SYBR® Green dye present in the mix. The result is an increase in fluorescent intensity which is directly proportional to the increase in dsDNA. This type of detection system is the simplest and most economical choice for qPCR but has its disadvantages in that it is not selective. False positives may result due to primer dimers and nonspecific amplification. It is, therefore, critical to design primers that reduce the chance of dimerization and nonspecific amplification.

Basics of Primer Design

The success of a conventional PCR to perform at maximum is dependent on having a good starting template, a Taq polymerase and buffer solution that are good quality and designing primers which are well-balanced between two parameters: specificity and efficiency. Specificity is important because mispriming will occur when primers are poorly designed. This leads to nonspecific amplification of sequences found in the template pool. Efficiency is also important in primer design. An efficient primer pair will produce a twofold increase in amplicon for each cycle of the PCR. Most primer design software programs are preset with default parameters for conventional PCR. This allows for the selection of primer pairs that produce a respectable balance between specificity to the target sequence and maximum efficiency when used with a conventional PCR assay but are not necessarily the best primers for a qPCR.

In a SYBR® Green-based qPCR application, specificity is very important. To understand this, it is important to remember how SYBR® Green works. SYBR® Green dye will bind to any dsDNA present in the reaction mix, so amplification of nonspecific products produces data that is invalid. Other factors to consider are the formation of primer dimers and efficiency. Primer dimers may increase fluorescence, resulting in inaccurate quantification of the amplicon. Efficiency (how well the primers perform) of a qPCR reaction should be as high as 90–100%. Efficient primers increase sensitivity of quantification and allow for assay reproducibility. Factors that affect the efficiency of a qPCR include the amplicon length and primer quality. In short, the key to developing good SYBR® Green-based primers is to find a pair of primers that are very specific, do not produce primer dimers, produce short amplicons, and are efficient enough to produce results that are consistent and reproducible. Knowing the common parameters, which can be adjusted in most primer design software, can aid in achieving this.

Common Parameters of Primer Design

Primer Length

The optimal length of primers is generally accepted as 18–24 bp in length. Longer primers will take longer to hybridize, longer to extend, and longer to remove thus produces less amplicon.

Primer Melting Temperature (Tm)

This is the temperature at which 50% of the primer and its complement are hybridized. To optimize for qPCR find primers of minimal length which have melting temperatures (Tm) that are between 59 and 68 °C, with an optimal Tm of 63–64 °C. Also, the Tm of the primer pair should be within 1 °C of each other. The primers should also have a Tm which is higher than the Tm of any template secondary structures (found using mFOLD software, discussed later).

Annealing Temperature

Optimal real-time PCR annealing temperatures are 59 °C or 60 °C.

Product Size

An ideal amplicon should be between 80 and 150 bp. If multiple genes are used, (i.e. comparing the relative expression of several genes) then the size of all amplicons should be close in length. SYBR® Green detection will produce a more intense fluorescence in larger products than smaller (so keep multiple products close in length).

Mg++ Concentration

The default is set to zero on most primer design software. SYBR® Green buffer mixes contain 3 to 6 mM of MgCl2.

Repeats

A repeat is a nucleotide sequence (a dinucleotide) that is repeated (e.g. TCTCTCTCTC). These should be avoided because they promote mispriming. If unavoidable, the maximum number should be 4 di-nucleotides.

Runs are repeated nucleotides (e.g. TAAAAAGC has a 5 bp run of Adenine). Runs should also be avoided because they are prone to mispriming. The maximum run should be no more than 3–4 bp.

3′ Stability

This refers to the maximum ΔG of the 5 bases from the 3′ end of the primers. (ΔG is the Gibbs Free Energy, the energy required to break the bonds present at the 3′ end) A higher 3′ stability will improve the efficiency of the primer.

GC Clamp

This refers to the maximum ΔG of the 5 bases from the 5′ end of the primers. Often called a GC clamp, the 5′ stability refers to how stable the 5′ end is due to the amount of Gs or Cs present at the 5′ end of the primer. Having 1 to 2 GC clamps are ideal, as it allows the primer to bind strongly to the template strand, making it more specific, however avoid more than 2 GC clamps.

Step-by-Step Example of Primer Design Using Primer3 Software

One of the most commonly used primer design software programs is Primer3 [ 7 ]. It can be used to design PCR primers, sequencing primers, and hybridization probes. Primer3 has many different input parameters which can be controlled to define characteristics that allow the software to design primers suitable for each goal. This section gives a step-by-step example of how to design primers using Primer3 and explains the functions of the most commonly used parameters. (Note: The following descriptions of Primer3 parameters are based on Primer3 website and may be verbatim in some cases.)

Step 1: Obtain Sequence in FASTA Format

Primer3 will accept sequences in FASTA, EMBL, and other formats. To explain the use of Primer3, a FASTA format sequence from the National Center for Biotechnology Information (NCBI) is used. NCBI is a government-funded, public database of genomic and other information relevant to biotechnology. (Note: The Populus trichocarpa (Poplar) dehydroquinate dehydratase/shikimate dehydrogenase (DHQD4) gene used in this example is NCBI accession number XM_002314438.1.)

From the dropdown menu (above the search box) select “Nucleotide.”

In the search box enter: XM_002314438.1. Click on “Search.”

When the results appear, click on “Display Settings” located at the top of the page (under the search bar, to the left, at the top of the page), select FASTA then click “apply.”

Optional: Open a Word document and copy the FASTA format sequence onto a blank sheet. This makes it easier to check the template for secondary structures later on in the experiment.

Step 2: Using Primer3

It looks intimidating but is easy to use once you become familiar with the search parameters. Primer3 software can be used to design primers for all types of PCR, so it has a multitude of options. After reading what the options do, students are instructed how to alter options to design primers for the DHQD4 gene.

Instruction: Go to the Primer3 website at: http://frodo. wi.mit.edu/primer3/

Copy and paste the DHQD4 FASTA format sequence from the Word document into the box provided on the Primer3 primer design page (Fig. 2).

Primer3 online software for primer selection. Input DNA sequence in FASTA format in the nucleotide box. Above, Populus tricocarpa DHQD4 sequence has been entered. NCBI identifiers (shown above as >gi|224107416|ref…mRNA) can be entered prior to the sequence but are not necessary.

Pick Left Primer, or Use Left Primer Below: If this option is left blank, the Primer3 program will chose the left primer. If, however, a left (or forward) primer sequence is already known, and the user only needs to create a right (or reverse) primer, the known sequence would be entered in this box.

Instruction: For the Poplar example, leave it blank.

Pick hybridization probe: A probe (e.g. TaqMan®) is not required in SYBR® Green detection, so leave this blank. When using probe-based fluorescent detection, a probe would be designed along with the primer set. Checking this option allows Primer3 to provide alist of suggested probes which would work with the primer set.

Instruction: For the Poplar example, leave it blank.

Pick Right Primer, or Use Right Primer Below: If this option is left blank, the Primer3 program will chose the right primer. If, however, a right (or reverse) primer sequence is already known, and the user only needs to create a left (or forward) primer the known sequence would be entered in this box.

Instruction: For the Poplar example, leave it blank.

Sequence Id: A name for the primer set.

Instruction: For the Poplar example, enter the following name: Populus trichocarpa DHQD4.

Targets: If primers need to be designed for a “specific” location in the sequence, the user can use brackets to tell Primer3 where to design primers (e.g. AA[TAGC]ACC) would tell Primer3 to design primer around the TAGC base pairs). This choice is helpful if you want to design primers for a specific sequence area.

Instruction: For the Poplar example, skip this option.

Excluded Regions: This option is very helpful if a certain part of the sequence needs to be avoided. For instance, if oligodT primers are used to perform reverse transcription to create cDNA, the 5′ end of the mRNA (if it is very long sequence) could not be represented in the cDNA as the oligodT primer may fall off before reaching it. In this case, it is necessary to avoid designing primers along the 5′ end and instead target the 3′ end of the sequence. Also, this option is very helpful if Primer3 software gives multiple primers from the same location (that aren't satisfactory), or gives primers that create an amplicon that has a lot of secondary structures (more about that later, when we discuss mFold values). To avoid an area, enter the values as a comma separated list (e.g: 81,6 where 81 is the bp position you want Primer3 to start this command and 6 is how many bp following the nucleotide at position 81 it should avoid).

Instruction: For the Poplar example, leave blank.

Product Size Ranges: This is the size of your amplicon. An optimal amplicon would be ∼120 bp in length. Generally, amplicons of 80–200 bp are acceptable however, longer amplicons give less efficient qPCR results because more SYBR® Green is incorporated.

Instruction: For the Poplar example:

Enter: 80–150 100–200 (this tells Primer3 to first look for primers which will produce amplicons between 80 and 150 bp, then look for primers which will produce amplicons between 100 and 200 bp.

Number to Return: This is how many primer sets Primer3 will return. This number is up to the user's discretion.

Instruction: For the Poplar example, enter 10.

Max 3Stability: This refers to the maximum ΔG of the 5 bases from the 3′ end of the primers. (ΔG is the Gibbs Free Energy G—the energy required to break the bonds present at the 3′ end) Higher 3′ stability will improve the efficiency of the primer. The higher this number is, the more stable your 3′ end is. (Note: the user may need to alter this number to obtain suitable primers.) Often the balance between efficiency and specificity is made more difficult due to secondary structure formation.

Instruction: For the Poplar example leave value at 9 (to return more efficient primers).

Max Repeat Mispriming: Repeats (e.g. ATATATATA) can cause mispriming (the result of a primer bonding to an unintended template). Some eukaryotes (human, drosophila and mouse for instance) have repeated segments that are notorious for mispriming. Because this is common, databases (called libraries) of sequences known to cause mispriming have been created. This option allows Primer3 to avoid areas of known mispriming when designing primers. If qPCR primers are being designed for human, mouse, or fruit fly sequences, a library should be chosen first. To chose a library, check which species is being used from the drop-down window (above the sequence input box at the top of the page). Then enter the maximum value in the “Max repeat mispriming” box. This value is the maximum allowed weighted similarity of the individual (forward or reverse) primer to all known repeated nucleotides which cause mispriming. To reduce the likelihood of mispriming, leave the number at 12 or increase the number. As this experiment uses a Poplar tree sequence Primer3 will not have a mispriming library to access, so leave the value at 12. Some computer savvy users create their own code to allow Primer3 to access mispriming data bases which they have created, but this technology is above the scope of this experiment and will not be discussed.

Instruction: For the Poplar example, leave the value at 12.

Pair max repeat mispriming: This value is the maximum allowed weighted similarity of the primer pair (both forward and reverse) to all known repeated nucleotides which cause mispriming. To reduce the likelihood of mispriming, leave it at 24 or increase the number.

Instruction: For the Poplar example, leave the value at 24.

Max Template Mispriming: Mispriming is the result of a primer binding to an unintended template resulting in amplification. This option checks individual primers for the likelihood that they will misprime to another area on the sequence provided. Template mispriming should be avoided in qPCR, otherwise an amplicon mixture of the intended product and a nonspecific product will be produced during amplification. Leave the value at 12 or increase the number to reduce the likelihood of mispriming. (Note: when a SYBR® Green-based qPCR is run, a no template control (NTC) should be used, and the thermocycler should be programmed to generate a melt curve to detect secondary products. If additional peaks are present in the melt curve, but no amplicon is detected in the NTC, primers should be redesigned as these peaks indicate that nonspecific products are being amplified).

Instruction: For the Poplar example, leave the value at 12.

Pair Max Template Mispriming: This option checks primer pairs for the likelihood that they will misprime on the template provided. Leave it at 24 or increase the number to reduce the likelihood of mispriming.

Instruction: For the Poplar example, leave the value at 24.

General Primer Picking Conditions: These are general options the user can set to pick primers.

Primer Size: Specificity can be controlled by finding a balance between the length of the primer and the annealing temperature of the PCR. The optimal length of primers is generally accepted as 18–28 bp in length. If using probes (e.g. TaqMan®) in a multiplex PCR, increase this length up to 35 bp. To optimize for SYBR® Green qPCR find primers of minimal length which have melting temperatures (Tm) that are between 62 and 67 °C, with an optimal Tm of 63 °C.

Instruction: For minimum value, enter 20 for Optimum, enter 25, For Maximum, enter 28

Primer Tm: This is the temperature at which 50% of the primer and its template complement are hybridized. Try to design primers with melting temperatures between 62 and 67 °C, with an optimal Tm of 62 °C to 64 °C. The Tm difference between the forward and reverse primers should be no more than 1–2 °C.

Instruction: Minimum, enter 60, Optimum, enter 64, Maximum, enter 70

Maximum Tm Difference, enter 2

Table of Thermodynamic Parameters: Primer3 uses these formulas to calculate the melting temperature. The recommended value is SantaLucia1998.

Instruction: For the Poplar example, set to SantaLucia1998.

Product Tm: This is the temperature at which 50% of the amplicon is ssDNA. The temperature varies depending upon the GC content of the template. Ideally, a targeted area on the template would have a GC content of 50%.

Instruction: For the Poplar example, set optimal to 50.

Primer GC: This is the minimum and maxiumum percentage of guanine and cytosine (GC) allowed. The GC content of primers is used to determine the melting temperature of the primer, which can be used to predict the annealing temperature. The melting temperature of primers is generally 3 to 5° below the annealing temperature. Ideally, qPCR primers should anneal at 59–60 °C. (Note: Most SYBR® Green master mix solutions contain specific amounts of buffer (salt) and MgCl2, which alter the primer melting temperature.)

Instruction: For the Poplar example: Minimum 35, Optimum 65, Maximum = 80.

Max Self Complimentary: Primers should not be self-complementary or complementary to each other. Primers that are self complementary form self-dimers or hairpin structures. As SYBR® Green dye will interact with any double stranded DNA structure, this value should be set as low as possible. Initially, set the value to 2. If Primer3 does not give primer sets, increase the value in increments of 1 and resubmit—repeat as necessary.

Instruction: For the Poplar example, set the value to 4.

Max 3Self-Complimentary: As polymerases add bases at the 3 end of the oligonucleotide, the 3-ends of primers should not be complimentary to each other, as primer dimers will occur. Sometimes this cannot be avoided. However, pay particular attention to complementation between primers at 2 or more bases at the 3 ends of the primers as these tend to form primers more readily (See Fig. 3). Set the value low (e.g. 2 or 3) and increase by increments of 1 if Primer3 does not supply a list of primers.

Instruction: For the Poplar example, set the value to 3.

Max #N: This is the maximum number of unknown bases which Primer3 could consider in making primers. Many genes, ESTs (Expressed Sequenced Tags) and cDNAs in NCBI's GeneBank contain unknown bases (N). The symbol N is given as a “place holder” when sequencing cannot determine the nucleotide (G,C,T or A) present at a certain location in the gene (or cDNA) sequence. To avoid nonspecific amplification, set this value to zero.

Instruction: For the Poplar example, set to 0

Max Poly-X: The maximum number of mononucleotide repeats to allow in the primer. Long mononucleotide repeats (e.g. AAAAAAA) can promote mispriming and should be avoided. As a general rule, runs of 3 or more Cs or Gs at the 3 ends of primers should be avoided, as their presence may promote mispriming at C or C-rich sequences.

Instruction: For the Poplar example, set to this value to 3.

Inside Target Penalty and Outside Target Penalty: Used if the primer needs to be designed to overlap a region (e.g. gap junctions). “If the primer is part of a pair that spans a target and overlaps the target, then multiply this value times the number of nucleotide positions by which the primer overlaps the (unique) target to get the ‘position penalty’ (from the Primer3 website). This parameter allows Primer3 to include the overlap of the primer with the targeted area of the sequence as a term in the objective function.

Instruction: Default is ok.

First Base Index: This parameter tells Primer3 which programming index type the first base in the input sequence is. GenBank (NCBI) uses one-based indexing.

Instruction: Default is fine.

GC Clamp: Defines the specific numbers of Gs and Cs at the 3 end of both the left and right primers. Although you want to place Gs or Cs on the 3 ends of your primer, no more than 2–3 G's and C's should be in the last 5 bases at the 3 end of the primer.

Instruction: Default of 0 is fine.

Conc. of monovalent cations: This is the millimolar concentration of KCl salt (most of the time) in the PCR. Leave at 50 μM, unless there is a reason you added more salt.

Instruction: Default is ok.

Salt Correction Formula. Factors such as ΔG and Tm affect PCR performance and alter the efficiency of primer pairs. As the Tm of a DNA sequence is dependent upon length, sequence, surrounding ionic environment, and pH of the environment, it is important to evaluate the thermodynamics of dissociation and association of the nucleotide strands during the PCR. Primer3 uses formulas that are based on the nearest neighbor model with salt correction. The SantaLucia 1998 salt formula is preferred by Primer3. This formula is designed to accommodate the salt correction independent of sequence but dependent on oligonucleotide length.

Instruction: For the Poplar sample, select SantaLucia 1998.

Conc. of Divalent Cations: This is the concentration of divalent salts (usually MgCl 2+ ) present in the PCR mix. SYBR® Green mixes usually contain ∼3 mM.

Instruction: Change to 3.5 mM (to adjust for MgCl in SYBR Green Supermix)

Conc. of dNTPs: A dNTP concentration of 200 μM is usually recommended for Taq polymerase to function efficiently in a conventional PCR, where MgCl2 concentrations are 1.5 mM. Increases in dNTP concentrations can inhibit PCR reactions by trapping free Mg. Some SYBR® Green master mixes come prepared with taq, KCL, MgCl2, and dNTP already in the mix. These mixes have been laboratory tested to give maximum performance.

Instruction: For the Poplar example, use 0.20 mM

Annealing Oligo Concentration: Used to calculate the oligo melting temperature, this is the nanomolar concentration of annealing oligos in the PCR. As the value is dependent upon the amount of oligos and the amount of template, it is difficult to calculate this value (given cDNA is used as a template). Primer3 claims that the default (50 nM) works well for most applications.

Instruction: For the Poplar example, default is ok.

Objective Function Penalty Weights for Primers: The penalty weights section allows Primer3 users to modify the criteria that Primer3 uses to select the best sets of primers. If no penalty weights are assigned, the program will use the information that the user provided to the “General Primer Picking” specifications and grade each set of primers based on those conditions. Using penalty weights the user tells Primer3, “this criteria is more important than another.” Users enter penalty weights in values of 0, 1, 2, 3, etc. with 0 being less important. For instance, one might decide that primer dimers are a bigger concern than secondary amplicons. Then, the Self Complementary option could be set to 3 and Template Mispriming to 2. Some parameters have two boxes (Lt and Gt). This less than (Lt)/greater than (Gt) option allows for more flexibility in picking primers. For instance, if the user has specified under “General Primer Picking Conditions” that the primer size (Size) should be between 18 bp and 27 bp, any primers that are considered will be penalized if they are less than 18 bp, or greater than 27 bp. A user could give a penalty of 2 for primers shorter than 18 bp and a penalty of 0 for primers greater than 27 (if longer primers would be acceptable).

Instruction: For the Poplar example, change the following penalty weights:


When designing primers how important is the GC clamp? - Biology

Designing Primers for PCR

The Primer Designer features a powerful, yet extremely simple, real-time interface to allow the rapid identification of theoretical ideal primers for your PCR reactions. Primer pairs are computed from the set target regions, then screened against a series of parameters to maximise priming efficiency for trouble-free PCR.

The main Primer Designer form essentially consists of two grids and some parameter controls. The grids show all the possible forward (left side) and reverse (right side) primers that conform to the set parameters, and fall within the specified target regions for each primer. You will immediately notice, that by making the selection conditions for the primers more stringent, the list of possible primers will diminish. This real-time screening process makes it possible to very quickly narrow down the list of potential primers, and select the one(s) that best suit the needs for your experiment.

The regions from which the primers are chosen can be visualised and adjusted on the Interactive Sequence Map. The regions are represented by outlined boxes, colored green for the forward primers and purple for the reverse primers. The regions can be shifted by dragging them with the mouse, and their size adjusted by clicking on their edges and stretching them to the desired size. For fine adjustment of the region's position or size, simply select the whole box or the appropriate edge, then use the left and right arrows to shift your selection to the exact desired position. The primer selection regions are also shown in the Sequence Editor as light green and purple shaded regions.

The positions of the currently selected forward and reverse primers in the tables on the Primer Designer form, are shown on the Interactive Sequence Map as solid green and purple bars, and on the Sequence Editor as darkly shaded green and purple regions.

Adjusting the Primer Selection Parameters

Various parameters can be adjusted on the Primer Designer form, allowing you to specify how the primers will be screened. Although the default settings of the parameters are adequate for a typical PCR reaction, you will probably need to adjust them to some extent depending on the nature of your experiment. The parameters and their functions are outlined in the table below:

ParameterFunction
Length RangeSpecifies the minimum and maximum lengths of the primers.
%GC RangeSpecifies the minimum and maximum percentage of GC content in the primer. Efficient primers generally have %GCs of around 50.
Tm RangeSpecifies the minimum and maximum melting temperature (in degrees Celcius) of the primer, as calculated by the Nearest Neighbor method (see below).
3' End StabilityDetermines the D G of the last 5 bases at 3' end. An unstable 3' end (less negative D G) will result in less false priming.
5' End Stability (GC Clamp)Determines the D G of the last 5 bases at 5' end. A stable 5' end (more negative D G) will result in more efficient and specific bonding to the template.
D G DimerSpecifies the minimum tolerable D G for primer dimer formation.
D G HairpinSpecifies the minimum tolerable D G for primer hairpin formation.

In the functions above, all the D G values are calculated according to nearest-neighbor method (Breslaur et al., 1986).

There are three commonly used methods for calculating the Tm. Expression uses the most accurate method, nearest-neighbor. The formulas and references for the different methods are summarised in the table below:


PCR Primer Design

Primer design for PCR
General Design considerations. Make sure that:

  • The primer length is between 15-30 bp homologous to the target DNA sequence. I suggest starting with 20-25 bp primers.
  • The Tm of each primer is between 55-65 °C
  • The GC content of each primer is between 40-60%
  • The Tm of both primers are very similar, i.e., within

Specific considerations for Golden Gate Parts

Specific considerations for BioBrick Parts

    • Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
    • I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
    • The Biobrick part starts with a start codon (ATG) and ends with two consecutive stop codons (TAATAA).
    • Then the forward primer should be of the form:

    5′ CCTTTCTAGAG (15-20 bp of the coding strand, starting ATG) 3′

    and the reverse primer should be of the form:

    5′ AAGG’CTGCAGCGGCCGCTACTAGT’A (15-20 bp reverse complement, starting TTATTA) 3′

    Here there are a four nucleotides (in italics) flanking the restriction sites (in bold) such spacers are required to allow the restriction enzymes to cut properly.

    Specific considerations for BioFusion Parts

    • Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
    • I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
    • The insert for the forward primer does not begin with TC (or else a DAM I site (GATC) is formed, and XbaI cannot cut).
    • The Biofusion construction does not begin with a start codon, nor does it end with a stop codon.
    • Then, the forward primer should be of the form:

    5′ ”CCTT””’TCTAGA”’ (15-20 bp of the coding strand) 3′
    and the reverse primer should be of the form:
    5′ ”AAGG””’CTGCAGCGGCCGCTACTAGT”’ (15-20 bp reverse complement) 3′
    Here there are a four nucleotides (in italics) flanking the restriction sites (in bold) such spacers are required to allow the restriction enzymes to cut properly.

    • Note: if it is not possible to make a good set of primers with the flanking regions described above, try changing the first 4 bases – which are external to the restriction site – of each primer, e.g. <br>5′ ”AAGG””’TCTAGA”’ (15-20 bp of the coding strand) 3′ <br>
    • Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part.

    In this case, the forward primer would be of the form: 5′ ”CCTT””’GAATTCGCGGCCGCATCTAGA”’ (15-20 bp complement to coding strand)3′ and the reverse primer should be of the form: <br> 5′ ”AAGG””’ACTAGT”’ (15-20 bp complement to coding strand) 3′.

    Designing Primers Using Vector NTI
    An easy way to design primers is to use Vector NTI.


    When designing primers how important is the GC clamp? - Biology

    For large templates such as BAC's, PAC's and cosmids which can have higher levels of impurities, we recommend the use of the SP6long primer instead of the standard SP6 primer, which has a marginally low Tm. The SP6long primer is four bases longer (so check for compatibility with your vectors) but works well for large templates when the shorter SP6 primer fails.

    Primer Design Considerations

    • A melting temperature (Tm) in the range of 50 C to 65 C
    • Absence of dimerization capability
    • Absence of significant hairpin formation (>3 bp)
    • Lack of secondary priming sites
    • Low to moderate specific binding at the 3' end (avoid high GC content to prevent mispriming)

    Finally, be aware that no set of guidelines will always accurately predict the success of a primer. Some primers may fail for no apparent reason, and primers that appear to be poor candidates may work well.


    BatchPrimer3 is yet another Primer3-based primer design software freely available online. There is a huge amount of primer subtypes to design including, generic PCR primers. BatchPrimer3 requires a FASTA sequence to be entered or uploaded. An intermediate selection of primer parameters are also there to tweak.

    The Eurofins Genomics’ Primer Design Tools uses the Prime+ program from the GCG Wisconsin Package, originally written by Irv Edelman. All that is required is a target sequence, which is copied and pasted into the program, then you have the option to tweak the design parameters. The output also includes a suggested annealing temperature to use for each primer pair.

    Do you have any free PCR primer design software suggestions to add to the list? Leave a comment below with your preferred choice and I will be sure to update the list.